Skip to main content

Table 1 List of real-time RT-PCR primers

From: Dexmedetomidine attenuates myocardial ischemia-reperfusion injury in vitro by inhibiting NLRP3 Inflammasome activation

mRNA Forward Reserve
GAPDH GTTACCAGGGCTGCCTTCTC ACCAGCTTCCCATTCTCAGC
NLRP3 GGTGACCTTGTGTGTGCTTG ATGTCCTGAGCCATGGAAGC
Caspase1 GACCGAGTGGTTCCCTCAAG GACGTGTACGAGTGGGTGTT
ASC GGACAGTACCAGGCAGTTCG GTCACCAAGTAGGGCTGTGT
IL-1β GGGATGATGACGACCTGC CCACTTGTTGGCTTATGTT
IL-18 CAACCGCAGTAATACGGAGC TCTGGTCTGGGATTCGTTGG
TNF-α TGATCGGTCCCAACAAGGA TGCTTGGTGGTTTGCTACGA